slogan

 
 

TỔNG HỢP TỪ NGHIÊN CỨU TRÊN LÂM SÀNG

TÓM TẮT

Đặt vấn đề:Nhồi máu cơ tim (NMCT) cấp vẫn còn là một trong những nguyên nhân chủ yếu của tử vong và tàn tật trên thế giới. Đây là một bệnh lý đa yếu tố với cơ chế bệnh sinh gồm các yếu tố di truyền và môi trường.

 

ThS.BS TRẦN CÔNG DUY1

ThS. LÊ GIA HOÀNG LINH2

TS.BS ĐỖ ĐỨC MINH2

PGS.TS.BS CHÂU NGỌC HOA1

1Bộ môn Nội Tổng Quát, Đại học Y Dược TP. Hồ Chí Minh

2Trung tâm Y Sinh Học Phân Tử, Đại học Y Dược TP. Hồ Chí Minh

 

Mục tiêu:Khảo sát mối liên quan của các kiểu gen và alen của biến thể gen AGT M235T, ACE I/D và AGTR1 A1166C với NMCT cấp.

 Phương pháp nghiên cứu:Nghiên cứu bệnh chứng gồm các bệnh nhân NMCT cấp và nhóm chứng được bắt cặp theo tuổi và giới tại khoa Nội Tim Mạch, bệnh viện Trưng Vương từ 11/2017 đến 01/2018. Kiểu gen được xác định bằng phương pháp PCR và giải trình tự DNA Sanger.

Kết quả: 30 bệnh nhân NMCT cấp và 30 bệnh nhân trong nhóm chứng tham gia nghiên cứu trong vòng 3 tháng. Tuổi trung bình của nhóm bệnh và nhóm chứng lần lượt là 65,8±13,6 và 60,6±13,3. Có 70% bệnh nhân nam và 30% bệnh nhân nữ ở mỗi nhóm. Phân tích hồi quy logistic cho thấy không có mối liên quan giữa kiểu gen và alen của biến thể gen AGT M235T và ACE I/D với NMCT cấp. Ở biến thể gen AGTR1 A1166C, kiểu gen AA có liên quan với nguy cơ NMCT thấp hơn (OR=0,11; KTC 95%: 0,01–0,99; P=0,049) trong khi kiểu gen AC (OR=8,826; KTC 95%: 1,01–76,96; P=0,049) và alen C (OR=8,826; KTC 95%: 1,01–76,96; P= 0,049) liên quan với nguy cơ NMCT cao hơn.

Kết luận:Kiểu gen và alen của biến thể gen AGTR1 A1166C có liên quan với nguy cơ NMCT cấp. Các biến thể gen AGT M235T và ACE I/D không liên quan với NMCT cấp. Nghiên cứu khác với quy mô lớn hơn cần được tiến hành để kiểm định mối liên quan này.

Từ khóa:nhồi máu cơ tim cấp, biến thể gen, AGT, M235T, ACE, I/D, AGTR1, A1166C

 

ABSTRACT

ASSOCIATION OF AGT M235T, ACE I/D AND AGTR1 A1166C GENE VARIANTS WITH ACUTE MYOCARDIAL INFARCTION

Tran Cong Duy, Le Gia Hoang Linh, Do Duc Minh, Chau Ngoc Hoa

 

Background:Acute myocardial infarction (AMI) remains one of the major causes of death and disability worldwide. It is a multifactorial disease influenced by environmental and genetic factors.

Objectives: To survey the association of genotypes and alleles of AGT M235T, ACE I/D và AGTR1 A1166C gene variants with AMI.

Methods:Acase-control study including AMI patients and age- and sex-matched controls was carried out from November 2017 to January 2018 at the Department of Cardiology, Trung Vuong Hospital. Genotypes were determined by the PCR and Sanger DNA sequencing method.

Results: There were 30 AMI patients and 30 controls attending our study during 3 months. The mean age of cases and controls was 65.8±13.6 and 60.6±13.3, respectively. There were 70.0 % men and 30.0% women in each group. Logistic regression analysis showed no association of genotypes and alleles of AGT M235T and ACE I/D gene variants with AMI. For AGTR1 A1166C gene polymorphism, AA genotype was associated with lower risk of AMI (OR=0.11; KTC 95%: 0.01–0.99; P=0.049) while AC genotype (OR=8.826; KTC 95%: 1.01–76.96; P=0.049) and allele C (OR=8.826; KTC 95%: 1.01–76.96; P=0.049) were associated with higher risk of AMI.

Conclusions:Genotypes and alleles of AGTR1 A1166C gene variant were associated with AMI risk. There was no association between AGT M235T và ACE I/D gene polymorphims with AMI. Further large-scale studies are requried to test this relationship.

Key words:acute myocardial infarction, gene variants, AGT, M235T, ACE, I/D, AGTR1, A1166C

 

I. ĐẶT VẤN ĐỀ

Ngày nay, nhồi máu cơ tim cấp vẫn còn là một trong những nguyên nhân chủ yếu của tử vong và tàn tật trên thế giới[19]. Đây là một bệnh lý đa yếu tố với cơ chế bệnh sinh gồm các yếu tố di truyền và yếu tố môi trường. Các yếu tố nguy cơ kinh điển của NMCT là tăng huyết áp, đái tháo đường, rối loạn lipid máu, hút thuốc lá, nam ≥ 45 tuổi, nữ ≥ 55 tuổi và tiền sử gia đình bệnh tim mạch sớm. Trong những thập niên qua, một số nghiên cứu nước ngoài đã được thực hiện để xác định các biến thể chức năng của một số gen tiềm năng và nguy cơ xuất hiện NMCT cấp.

Hệ renin – angiotensin – aldosterone (RAA) đóng vai trò quan trọng trong điều hòa huyết áp và cân bằng nội mô, và có liên quan với cơ chế bệnh sinh của NMCT. Mỗi thành phần của hệ RAA đại diện cho một ứng cử viên tiềm năng trong nguyên nhân gây ra NMCT. Angiotensinogen (AGT) là một protein ở gan tương tác với renin sản xuất ra angiotensin I, tiền hormone này được biến đổi thành angiotensin II qua tác dụng của angiotensin-converting enzyme (ACE). Angiotensin II là phân tử tác dụng chủ yếu của hệ RAA, gây co mạch, đặc biệt là động mạch vành bằng cách hoạt hóa hệ thần kinh giao cảm, kích thích tăng sinh nguyên bào sợi, ảnh hưởng gây độc trực tiếp lên tế bào cơ tim, tái cấu trúc mạch máu, bài tiết aldosterone, rối loạn chức năng nội mô và xơ vữa động mạch do tăng stress oxy hóa[2].

Gen AGT nằm trên nhiễm sắc thể (NST) số 1, gồm 5 exon và 4 intron, kéo dài 13 kb và có nhiều biến thể, trong đó biến thể M235T (rs699) nằm trên exon 2 được quan tâm nhiều nhất với sự thay đổi axit amin ở vị trí 235 từ Methionin thành Theronin. Gen mã hóa ACE nằm trên nhánh dài NST số 17 (17q21), có chiều dài là 21 kb với 26 exon và 25 intron. Trên gen ACE, biến thể phổ biến và được cho là có liên quan với NMCT là biến thể I/D (insertion/deletion). ACE I/D (rs1799752) không phải là một biến thể thực sự, mà là sự thêm vào (insertion) hoặc mất (deletion) một đoạn DNA dài 287 bp nằm ở intron 16. Gen thụ thể Angotenin II típ 1 (AGTR1) gồm 5 exon và 4 intron nằm trên nhánh dài NST số 3 (3q21-25) và có chiều dài hơn 55Kb. Biến thể A1166C (rs5186) được nghiên cứu nhiều nhất trên gen AGTR1. Tính đa hình trong biến thể này là sự thay thế A với C tại vi trí nucleotide 1166, nằm tại vùng không dịch mã 3’ của chuỗi mRNA.

Cho đến thời điểm hiện tại, mối liên quan giữa các biến thể gen của hệ RAA với nguy cơ NMCT cấp chưa được nghiên cứu ở nước ta. Vì vậy, chúng tôi tiến hành nghiên cứu này để bước đầu khảo sát xem kiểu gen và alen của biến thể gen AGT M235T, ACE I/D và AGTR1 A1166C có phải là yếu tố nguy cơ của NMCT cấp ở người Việt Nam.

II. MỤC TIÊU NGHIÊN CỨU

Khảo sát mối liên quan giữa các kiểu gen và alen của biến thể M235T trên gen AGT, biến thể I/D trên gen ACE và biến thể A1166C trên gen AGTR1 với nhồi máu cơ tim cấp.

III. ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU

  1. Thiết kế nghiên cứu

Nghiên cứu bệnh chứng

  1. Đối tượng nghiên cứu

Bệnh nhân NMCT cấp nhập khoa Nội Tim Mạch, bệnh viện Trưng Vương từ 11/2017 đến 01/2018.

Nhóm chứng: Những người không mắc NMCT cấp nhập khoa Nội Tim Mạch, bệnh viện Trưng Vương từ 11/2017 đến 01/2018 được bắt cặp với các bệnh nhân trong nhóm bệnh theo tuổi (±5) và giới tính.

  1. Tiêu chuẩn chọn bệnh
  2. Nhóm bệnh:

-          Bệnh nhân nam hoặc nữ, ≥ 18 tuổi

-          Được chẩn đoán xác định NCMT cấp

-          Đồng ý tham gia nghiên cứu

·         Nhóm chứng:

-          Nam hoặc nữ ≥ 18 tuổi

-          Không có tiền căn hoặc đang mắc NMCT

-          Đồng ý tham gia nghiên cứu

  1. Tiêu chuẩn loại trừ

-          Khôngđồng ý tham gia nghiên cứu

-          Không đủ dữ liệu để thu thập

  1. Kỹ thuật chọn mẫu: chọn mẫu liên tiếp
  2. Phương pháp thu thập số liệu: mẫu thu thập dữ liệu soạn sẵn được hoàn thành bằng cách hỏi bệnh, khám lâm sàng và thực hiện các xét nghiệm cận lâm sàng để chẩn đoán NMCT cấp, các yếu tố nguy cơ bệnh mạch vành, thể lâm sàng NMCT cấp, phân độ Killip, kiểu gen và alen của các biến thể gen.
  3. Nhồi máu cơ tim cấp: được chẩn đoán tại bệnh viện Trưng Vương theo định nghĩa toàn cầu lần thứ 3 của ESC/ACCF/AHA/WHF 2012 [15]: tăng và/hoặc giảm giá trị của Troponin I với ít nhất một giá trị trên bách phân vị thứ 99 của giới hạn trên khoảng tham chiếu và ít nhất một trong các yếu tố sau: triệu chứng thiếu máu cục bộ cơ tim; thay đổi ECG của thiếu máu cục bộ cơ tim mới (thay đổi ST-T hoặc blốc nhánh trái mới xuất hiện); xuất hiện sóng Q bệnh lý mới trên ECG; chứng cứ hình ảnh rối loạn vận động vùng mới xuất hiện trên siêu âm tim; xác định huyết khối trong lòng động mạch vành bằng chụp động mạch vành cản quang.
  4. Xác định kiểu gen: Kiểu gen của các biến thể gen AGT M235T (MM, TT, MT), ACE I/D (II, DD, ID), AGTR1 A1166C (AA, CC, AC) được xác định tại Trung tâm Y Sinh học Phân tử, Đại học Y Dược TP. Hồ Chí Minh. Mỗi bệnh nhân được lấy 2 ml máu tĩnh mạch, cho vào ống chống đông có EDTA. Genomic DNA được tách chiết trong vòng 24 giờ bằng bộ kit GeneJet TM whole blood genomic DNA purification (Thermo, Mỹ). Mỗi tube PCR có thể tích 15 ml chứa các thành phần: 1,5μl PCR buffer 10X; 1,5μl dNTP 2,5mM; 0,75μl mỗi mồi xuôi và ngược (10nM/μl), 0,1μl TaKaRa TaqTM HotStart Polymerase (Takara, Nhật Bản), 2μl genomic DNA (20-50ng/μl) và 8,4μl nước cất 2 lần khử ion. Các phản ứng luôn kèm theo một chứng âm không chứa DNA để kiểm soát ngoại nhiễm. Chu trình luân nhiệt cho PCR được thực hiện trên máy Mastercycler@Pro S (Eppendorf, Đức). Sản phẩm PCR được kiểm tra bằng điện di trên thạch agarose và quan sát bằng hệ thống chụp ảnh điện di Geldoc-ItTM (UVP, Mỹ). Đối với gen AGT và AGTR1, sản phẩm PCR được giải trình tự bằng phương pháp Sanger. Trình tự DNA được đọc bằng máy ABI 3130 Genetic Analyzer, với POP-7 polymer và capillary 50 cm (Applied Biosystems, Mỹ) và kết quả giải trình tự được phân tích bằng phần mềm CLC Main Workbench.

 

Gen

Đoạn mồi

Trình tự (5’-->3’)

ACE

Mồi xuôi

ACTCTGTAAGCCACTGCTGG

Mồi ngược

GATGTGGCCATCACATTCGTCA

AGT

Mồi xuôi

CCACGCTCTCTGGACTTCAC

Mồi ngược

TTCTCAAGGGTGGTCACCAG

AGTR1

Mồi xuôi

ATCCACCAAGAAGCCTGCAC

Mồi ngược

CTTCGAGCAGCCGTCATCTG

 
  1. Phương pháp xử lý và phân tích số liệu

Dữ liệu nghiên cứu được xử lý bằng phần mềm Microsoft Excel 2007 và SPSS 16.0 for Window. Các biến định tính được trình bày theo tần số, tỷ lệ và so sánh tỷ lệ trung bình giữa các biến bằng phép kiểm Chi bình phương. Các biến định lượng được trình bày dưới dạng trung bình ± độ lệch chuẩn (TB ± ĐLC) nếu phân phối chuẩn và so sánh tỷ lệ trung bình giữa các biến bằng phép kiểm t mẫu ghép cặp. Phân tích mối liên quan giữa kiểu gen và alen của các biến thể gen với NMCT cấp bằng hồi quy logistic với tỉ số số chênh OR và khoảng tin cậy (KTC) 95%. Kết quả của một phép kiểm khác biệt có ý nghĩa thống kê khi p < 0,05.

IV.             KẾT QUẢ

Trong thời gian 3 tháng, nghiên cứu của chúng tôi có 30 bệnh nhân NMCT và 30 người trong nhóm chứng tham gia. Tuổi trung bình của nhóm NMCT (65,8 ± 13,6) và nhóm chứng (60,6 ± 13,3) khác nhau không có ý nghĩa thống kê (P = 0,140). Tỷ lệ nam/nữ của nhóm bệnh và nhóm chứng giống nhau (nam chiếm 70%, nữ chiếm 30%). Các đặc điểm về yếu tố nguy cơ bệnh mạch vành, thể lâm sàng nhồi máu cơ tim và phân độ Killip được trình bày ở bảng 1.

Bảng 1. Đặc điểm dân số nghiên cứu

Đặc điểm

Nhóm NMCT

Nhóm chứng

P

Tuổi (năm), TB ± ĐLC

65,8 ± 13,6

60,6 ± 13,3

0,140

Giới tính

Nam, n (%)

Nữ, n (%)

 

21 (70)

9 (30)

 

21 (70)

9 (30)

 

1,000

Béo phì, n (%)

6 (20)

8 (22)

0,542

Tăng huyết áp, n (%)

24 (80)

23 (76,7)

0,754

Đái tháo đường, n (%)

7 (23,3)

6 (20)

0,754

Hút thuốc lá, n (%)

20 (66,7)

18 (60,0)

0,426

Rối loạn lipid máu, n (%)

16 (53,3)

10 (33,3)

0,118

Thể lâm sàng

NMCT cấp ST chênh lên, n (%)

NMCT cấp không ST chênh lên, n (%)

 

13 (43,3)

17 (56,7)

 

 

Phân độ Killip

Killip I, n (%)

Killip II, n (%)

Killip III, n (%)

Killip IV, n (%)

 

20 (66,7)

8 (26,7)

2 (6,6)

0 (0)

 

 

 

Tần số kiểu gen, alen của các biến thể gen AGT 235T, ACE I/D và AGTR1 được trình bày ở bảng 2 và bảng 3. Bảng 4 và bảng 5 trình bày kết quả phân tích mối liên quan giữa các biến thể gen với NMCT cấp. Phân tích hồi quy logistic cho thấy không có mối liên quan giữa kiểu gen và alen của biến thể gen AGT M235T và ACE I/D với NMCT cấp, trong khi đó ở  biến thể gen AGTR1 A1166C, kiểu gen AA làm giảm nguy cơ NMCT (OR = 0,11; KTC 95%: 0,01 – 0,99; P = 0,049); kiểu gen AC (OR = 8,826; KTC 95%: 1,01 – 76,96; P = 0,049) và alen C (OR = 8,826; KTC 95%: 1,01 – 76,96; P = 0,049) gia tăng nguy cơ NMCT cấp.

Bảng 2. Tần số kiểu gen của các gen hệ renin – angiotensin - aldosterole

Gen

Nhóm NMCT

Nhóm chứng

P

AGT M235T

MM, n (%)

TT, n (%)

MT, n (%)

 

0 (0,0)

22 (73,3)

8 (26,7)

 

0 (0)

23 (76,7)

7 (23,3)

 

1,000

0,766

0,766

ACE I/D

II, n (%)

DD, n (%)

ID, n (%)

 

16 (53,3)

11 (36,7)

8 (26,7)

 

13 (43,3)

10 (33,3)

7 (23,4)

 

0,438

0,787

0,166

AGTR1 A1166C

AA, n (%)

CC, n (%)

AC, n (%)

 

23 (76,7)

0 (0,0)

7 (23,3)

 

29 (96,7)

0 (0,0)

1 (3,3)

 

0,023

1,000

0,023

 

Bảng 3. Tần số alen của các gen hệ renin – angiotensin - aldosterole

Gen

Nhóm NMCT

Nhóm chứng

P

AGT M235T

M, n (%)

T, n (%)

 

8 (13,3)

52 (86,7)

 

7 (11,7)

53 (88,3)

 

0,766

0,766

ACE I/D

I, n (%)

D, n (%)

 

35 (58,3)

25 (41,7)

 

33 (55,0)

27 (45,0)

 

0,376

0,376

AGTR1 A1166C

A, n (%)

C, n (%)

 

53 (83,3)

7 (11,7)

 

59 (98,3)

1 (1,7)

 

0,023

0,023

 

Bảng 4. Mối liên quan giữa các biến thể gen hệ renin – angiotensin – aldosterole và nhồi máu cơ tim cấp

Gen

OR

KTC 95%

P

AGT M235T

TT

MT

 

0,84

1,20

 

0,26 – 2,70

0,37 – 3,85

 

0,766

0,766

ACE I/D

II

DD

ID

 

1,50

1,16

0,37

 

0,54 – 4,14

0,40 – 3,35

0,09 – 1,58

 

0,439

0,787

0,177

AGTR1 A1166C

AA

AC

 

0,11

8,83

 

0,01 – 0,99

1,01 – 76,96

 

0,049

0,049

 

Bảng 5. Mối liên quan giữa alen của các gen hệ renin – angiotensin – aldosterole và nhồi máu cơ tim cấp

Gen

OR

KTC 95%

P

AGT M235T

M

T

 

1,20

0,84

 

0,37 – 3,85

0,26 – 2,70

 

0,766

0,766

ACE I/D

I

D

 

1,09

0,92

 

0,62 – 1,90

0,53 – 1,62

 

0,755

0,755

AGTR1 A1166C

A

C

 

0,11

8,83

 

0,01 – 0,99

1,01 – 76,96

 

0,049

0,049

 

V.  BÀN LUẬN

1.      Đặc điểm dân số nghiên cứu

Nghiên cứu bệnh chứng này có đặc điểm dân số và yếu tố nguy cơ bệnh động mạch vành tương đồng giữa hai nhóm. Đa số người tham gia là người cao tuổi (tuổi trung bình 65,8 ở nhóm NMCT và 60,6 ở nhóm chứng) và giới tính nam (70%). Đặc điểm về tuổi và giới của nghiên cứu này phù hợp với các nghiên cứu trong và ngoài nước[9],[10]. Trong các yếu tố nguy cơ bệnh động mạch vành, tăng huyết áp và hút thuốc lá có tần số cao nhất (80% và 66,7% ở các bệnh nhân NMCT). Ở nhóm NMCT, thể lâm sàng NMCT cấp không ST chênh lên có tỷ lệ cao hơn NMCT cấp ST chênh lên (56,7% so với 43,3%) và mức độ suy bơm Killip I chiếm chủ yếu (66,7%), chỉ có 6,6% bệnh nhân có phân độ Killip III và không bệnh nhân nào bị choáng tim với Killip IV.

Biến thể M235T trên gen AGT

Trong nghiên cứu của chúng tôi, kiểu gen TT chiếm tỷ lệ nhiều nhất với 73,3% ở nhóm NMCT và 76,7% ở nhóm chứng, không có bệnh nhân nào mang kiểu gen MM. Alen T có tần số cao nhất ở những bệnh nhân NMCT (86,7%) lẫn người không NMCT (88,3%). Tuy nhiên, nghiên cứu chưa phát hiện mối liên quan giữa kiểu gen hay alen của biến thể M235T với nguy cơ NMCT cấp. Kamitani và cs lần đầu tiên báo cáo rằng tính đa hình gen AGT M235T làm tăng nguy cơ NMCT trong một nghiên cứu bệnh chứng với 103 bệnh nhân NMCT và 103 người thuộc nhóm chứng, tất cả đều là người Nhật[7]. Kiểu gen TT thường gặp ở bệnh nhân NMCT hơn nhóm chứng (P < 0,05) và là yếu tố tiên lượng NMCT[7]. Tuy nhiên, một số nghiên cứu và phân tích gộp cho thấy tính đa hình gen AGT M235T không liên quan với NMCT[14],[20]. Một phân tích gộp của Yu-Jing Wang và Yan Pan gồm 21 nghiên cứu bệnh chứng với 5.887 bệnh nhân NMCT và 6.164 người thuộc nhóm chứng kết luận rằng không có mối liên quan giữa AGT M235T và nguy cơ NMCT trong dân số chung. Tuy nhiên, phân tích dưới nhóm theo chủng tộc phát hiện tính đa hình M235T có liên quan với nguy cơ NMCT ở những người châu Á (OR = 1,47; KTC 95%: 1,01 – 2,12)[18]. Điều này gợi ý có vai trò của chủng tộc trong cơ chế di truyền và môi trường bệnh nhân sinh sống.

Biến thể I/D trên gen ACE

Ở các bệnh nhân NMCT, biến thể gen ACE I/D có tần số kiểu gen II cao nhất (53,3%), tiếp theo là kiểu gen DD (36,7%) và kiểu gen dị hợp tử ID ít nhất (10,0%). Về alen, alen I chiếm tỷ lệ cao hơn ở cả hai nhóm: 58,3% đối với nhóm NMCT và 55,0% đối với nhóm chứng. Sự khác biệt tỷ lệ kiểu gen và alen của biến thể gen ACE I/D giữa nhóm NMCT và nhóm chứng chưa đạt mức có ý nghĩa thống kê. Trong những thập niên qua, nhiều nghiên cứu đã được thực hiện để phân tích mối liên quan giữa biến thể gen ACE I/D và NMCT cấp kể tử khi Cambien và cs lần đầu tiên báo cáo rằng kiểu gen ACE DD và alen D có thể là một yếu tố nguy cơ của NMCT[4]. Mối liên quan giữa kiểu gen DD và NMCT cấp được phát hiện ở nhiều dân số khác nhau[3],[12],[13]. Theo một phân tích gộp của Zhao W, Ma ST và Cui LQ gồm 8 nghiên cứu với 828 bệnh nhân NMCT và 781 người trong nhóm chứng thuộc dân tộc Hán (Trung Quốc), tính đa hình ACE I/D liên quan với NMCT ở tất cả mô hình di truyền (II so với DD: OR = 0,40, KTC 95%: 0,31-0,53; II so với DI: OR = 0,72, KTC 95%: 0,57-0,91; mô hình trội: OR  =1,74, KTC 95%: 1,41-2,16; mô hình lặn: OR = 0,47, KTC 95%: 0,38-0,60)[22]. Tuy nhiên, nhiều nghiên cứu lớn khác chưa nhận thấy mối liên quan mạnh giữa ACE I/D và NMCT cấp ở các dân số khác nhau như Đan Mạch, Đức, Anh và người Da Trắng gốc Châu Âu[1],[6],[7],[17]. Kết quả khác nhau trong các nghiên cứu này có thể do sự khác biệt về cơ sở di truyền của những dân số khác nhau, cở mẫu, sai lệch trong chọn lựa nhóm chứng và sai lệch trong cân bằng Hardy-Weinberg.

Biến thể A1166C trên gen AGTR1

Qua kết quả được trình bày ở bảng 2 và bảng 3, chúng tôi nhận thấy kiểu gen AA chiếm đa số ở 2 nhóm (76,7% ở nhóm NMCT và 96,7% ở nhóm chứng) nhưng nhóm chứng cao hơn một cách có ý nghĩa thống kê (P = 0,023); ngược lại, kiểu gen AC ở nhóm NMCT cao hơn có ý nghĩa (23,3% so với 3,3%; P = 0,023); không có người nào mang kiểu gen đồng hợp tử CC. Phân tích hồi quy logistic cho thấy kiểu gen AA làm giảm nguy cơ NMCT (OR = 0,11; KTC 95%: 0,01 – 0,99; P = 0,049), trong khi kiểu gen AC (OR = 8,826; KTC 95%: 1,01 – 76,96; P = 0,049) và alen C (OR = 8,826; KTC 95%: 1,01 – 76,96; P = 0,049) gia tăng nguy cơ NMCT cấp. Kết quả này phù hợp với phát hiện trong các nghiên cứu của Fernandez-Arcas N[5] và Mehri S[11]. Vào năm 1994, Tiret và cs lần đầu tiên báo cáo alen C có liên quan với NMCT [16]. Dù một số nghiên cứu cho thấy không có mối liên quan giữa tính đa hình gen AGTR1 và nguy cơ NMCT cấp nhưng phân tích gộp với 16 nghiên cứu bệnh chứng của Zhang H và cs cũng kết luận rằng kiểu gen CC và alen C của điểm đa hình A1166C trên gen AGTR1 có liên quan với NMCT. Trong phân tích gộp đó gồm 6.194 bệnh nhân NMCT và 5.716 người thuộc nhóm chứng, sự phân bố kiểu gen ở nhóm chứng là 57,3% AA, 35,9% AC và 6,8% CC. So với kiểu gen AA, những người mang kiểu gen CC có nguy cơ NMCT cao hơn đáng kể (OR = 1,35; KTC 95%: 1,05-1,73; P = 0,02)[21]. Hơn nữa, alen C làm tăng nguy cơ dễ mắc NMCT hơn alen A (OR = 1,17; KTC 95%: 1,04-1,31; P = 0,008)[21].

KẾT LUẬN

Qua nghiên cứu 60 bệnh nhân ở nhóm NMCT và nhóm chứng, chúng tôi nhận thấy kiểu gen và alen của biến thể gen AGTR1 A1166C có liên quan với nguy cơ NMCT cấp. Các kiểu gen và alen của biến thể gen AGT M235T và ACE I/D không liên quan với NMCT cấp. Trong tương lai, nghiên cứu khác với quy mô lớn hơn cần được tiến hành để kiểm định mối liên quan này ở dân số Việt Nam.

 

TÀI LIỆU THAM KHẢO

1.    Agerholm-Larsen B, Nordestgaard BG, Tybjaerg-Hansen A (2000). ACE gene polymorphism in cardiovascular disease: meta-analyses of small and large studies in whites. Arterioscler Thrombo Vasc Biol, 20: 484-492.
2.    Bader M, Wagner J, Lee MA, et al (1994). The role of the renin-angiotensin system in cardiovascular disease. Hypertens Res, 17: 1-16.
3.    Bautista LE, Ardila ME, Gamarra G, et al (2004). Angiotensin-converting enzyme gene polymorphism and risk of myocardial infarction in Colombia. Med Sci Monit, 10: CR473-CR479.
4.    Cambien F, Poirier O, Lecerf L, et al (1992). Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature, 359: 641-644.
5.    Fernandez-Arcas N, Dieguez-Lucena JL, Munoz-Moran, et al (1999). The genotype interactions of methylenetetrahydrofolate reductase and renin-angiotensin system genes are associated with myocardial infarction. Atherosclerosis, 145: 293-300.
6.    Holmer SR, Bickeboller H, Hengstenberg C, et al (2003). Angiotensin-converting enzyme gene polymorphism and myocardial infarction: a large association and linkage study. Int J Biochem Cell Biol, 35: 955-962.
7.    Kamitani A, Rakugi H, Higaki J, et al (1995). Enhanced predictability of myocardial infarction in Japanese by combined genotype analysis. Hypertension, 25: 950-953.
8.    Keavney B, McKenzie C, Parish S, et al (2000). Large-scale test of hypothesised associations between the angiotensin-converting enzyme insertion/deletion polymorphism and myocardial infarction in about 5000 cases and 6000 controls. International Studies of Infarct Survival (ISIS) Collaborators. Lancet, 5355: 434-442.
9.    Lê Huy Thạch (2012). Yếu tố tiên lượng trong nhồi máu cơ tim cấp tại khoa hồi sức tích cực Bệnh viện Ninh Thuận. Tạp chí Chuyên Đề Tim Mạch Học.
10.    Mehri S, Baudin B, Mahjoub S, et al (2010). Angiotensin-converting enzyme insertion/deletion gene polymorphism in a Tunisian healthy and acute myocardial infarction population. Genetic Testing And Molecular Biomarkers, 14(1): 85-91.
11.    Mehri S, Mahjoub S, Finsterer J, et al (2011). The CC genotype of the angiotensin II type I receptor gene independently associates with acute myocardial infarction in a Tunisian population. J Renin Angiotensin Aldosterone, DOI: 10.1177/147032310391833.
12.    Mendonca I, Freitas IA, Sousa CA, et al (2004). Angiotensin-converting enzyme gene polymorphism and coronary risk in a Portuguese population. Rev Port Cardio, 23: 1593-1601.
13.    Seckin D, IIhan N, et al (2006). The relationship between ACE insertion/deletion polymorphism and coronary artery disease with or without myocardial infarction. Clin Biochem 2006; 39: 50-54.
14.    Sethi AA, Nordestgaard BG and Tybjaerg-Hansen A (2003). Angiotensinogen gene polymorphism, plasma angiotensinogen, and risk of hypertension and ischemic heart disease: A meta-analysis. Arterioscler Thromb Vasc Biol, 23: 1269-1275.
15.    Thygesen K, Alpert JS, Jaffe AS (2012). Third universal defenition of myocardial infarction. European Heart Journal, 33: 2551–2567. doi:10.1093/eurheartj/ehs184
16.    Tiret L, Bonnardeaux A, Poirier O, et al (1994). Synergistic effects of angiotensin-converting enzyme and angiotensin II type 1 receptor gene polymorphism on risk of myocardial infarction. Lancet, 344: 910-913.
17.    van Bockxmeer FM, Mamotte CD, Burke V, et al (2000). Angiotensin-converting enzyme gene polymorphism and premature coronary heart disease. Clin Sci (Lond), 99: 247-251.
18.    Wang YJ and Pan Y (2014). The M235T polymorphism in the angiotensinogen gene and myocardial infarction: A meta-analysis. Journal of the Renin-Angiotensin-Aldosterone System, 15(3): 294-300.
19.    White HD and Chew DP (2008). Acute myocardial infarction. Lancet, 372: 570-584.
20.    Xu MQ, Zhang Ye, Frank B, et al (2007). Quantitative assessment of the effect of angiotensinogen gene polymorphisms on the risk of coronary heart disease. Circulation, 116: 1356-1366.
21.    Zhang H, Sun ML, Peng J, et al (2011). Association of the angiotensin type 1 receptor gene A1166C polymorphism with myocardial infarction: a meta-analysis. J Thromb Haemost, 9: 1258-1260.
22.    Zhao W, Ma ST and Cui LQ (2015). Meta-analysis of angiotensin-converting enzyme insertion/deletion polymorphism and myocardial infarction in Han Chinese. Genetics and Molecular Research, 14(3): 8068-8076.